Journal: Journal of Cellular and Molecular Medicine

Article Title: Ultrastructure damage of oviduct telocytes in rat model of acute salpingitis

doi: 10.1111/jcmm.12548

Figure Lengend Snippet: TCs immunodiagnostics by double-labelled immunofluorescence. Dotted arrows indicated CD34-positive vascular endothelial cells. Negative c-kit staining was not shown here; scale bar = 20 μm. (A) CD34 (red) in moniliform cells overlying vimentin (green) cells with DAPI counterstaining (blue) in sham control (solid arrows), indicated the existence of perivascular TCs with special immunophenotype of CD34/vimentin double-positive. (B and C) CD34/vimentin double-positive cells with specific TCs morphology and well-defined nuclei was significantly less densely stained, reduced, sparse or completely absent (solid arrows) in AS-affected oviduct tissues. A statistically significant decrease in the mean number of TCs occurred ( P = 0.000). * P < 0.05 versus sham control; error bars = SD.

Article Snippet: Then FITC-goat antimouse IgG for vimentin (1:50; cat no. BA1101), CY3-goat anti-rabbit IgG for CD34 (1:50; cat no. BA1032), TRITC-goat anti-rabbit IgG for c-kit (1:50; cat no. BA1090) were added (all from Boster).

Techniques: Immunofluorescence, Staining, Control

Journal: Journal of Cellular and Molecular Medicine

Article Title: Ultrastructure damage of oviduct telocytes in rat model of acute salpingitis

doi: 10.1111/jcmm.12548

Figure Lengend Snippet: TCs and Tps damage in AS-affected oviduct tissues, accompanied by excessive amount of collagen fibres (Coll) and tissue fibrosis. (A) Intercellular connection between damaged TCs and activated mononuclear cells (MC). (a) Degenerated Tps established closed contact to activated MC which contained dense secretory granules, together with granulocyte infiltration, mainly eosinophils (Eo) and neutrophils (PMN). b higher magnification of the boxed area; (b) synapse (black arrows) between activated MC and degenerated Tps, which contained lots of swollen mitochondria (m) and vacuoles (white arrows), thus indicating degeneration, functional insufficiency of TCs and involvement of TCs in local immunoregulation. (B) Degeneration, discontinue or dissolution of TCs and Tps (black arrows), with cytoplasmic vacuolization (white arrows), accompanied by nearly normal scattered putative stem cells (SCs). Intercellular contacts between TCs and SCs was getting wider or disappeared (black asterisks). (C) Disrupted TC-SC niches which composed of a group of damaged Tps and putative SCs in myosalpinx, with heterocellular contacts getting wider or disappeared between Tps and SCs (black asterisks), Tps and activated Eosinophils (Eo) (white asterisk) with dense secretory granules respectively. Degeneration, discontinue or dissolution of TCs and Tps (black arrows), with swollen mitochondria (m), cytoplasmic vacuolization (white arrows) in Tps, swollen and dissolution of SMCs can be observed. (D) Severely damaged perivascular TCs and Tps, with swollen mitochondria (m), rough endoplasmic reticulum (rER) dilatation and cytoplasmic vacuolization (white arrows), together with damaged endothelial cell (E) and pericytes (P).

Article Snippet: Then FITC-goat antimouse IgG for vimentin (1:50; cat no. BA1101), CY3-goat anti-rabbit IgG for CD34 (1:50; cat no. BA1032), TRITC-goat anti-rabbit IgG for c-kit (1:50; cat no. BA1090) were added (all from Boster).

Techniques: Functional Assay, Dissolution

Journal: bioRxiv

Article Title: DLL4 and PDGF-BB regulate migration of human iPSC-derived skeletal myogenic progenitors

doi: 10.1101/2021.02.28.431778

Figure Lengend Snippet: (A) Principal Component Analysis (PCA) showing mMuSC-derived myoblasts (left), human myoblasts (centre) and hiMPs (right). 4 cell lines were analysed with RNAseq in treated and untreated conditions for each cell population. Each point on the PCA represents a cell population. Additional information in Table S1,2. (B) Volcano plots visualising differentially expressed genes between untreated and DLL4 & PDGFBB-treated mMuSCs, human myoblasts and hiMPs. Red dots represent genes which display a positive fold-change in expression upon treatment with DLL4 & PDGF-BB whilst violet dots represent genes which are significantly downregulated. Differentially expressed genes required a P value of ≤ 0.05. (C) Heatmaps showing changes in expression of key myogenic ( MYOD, MYOGENIN ), perivascular ( PDGFRB, NG2, CD146, ALPL ) and NOTCH target ( HEY1, HES1 ) genes upon treatment with DLL4 & PDGF-BB in mMuSC-derived myoblasts (left), human myoblasts (middle) and hiMPs (right). Clustering was performed by genes/probes with Pearson correlation. Colour scale based on z-scores: red regions indicate high expression whilst blue regions indicate low expression. Dendrograms indicate the similarity of clusters as well as the orders in which clusters were assembled. (D) Validation of RNAseq data of panel (C) by real-time PCR analysis of the same myogenic, perivascular and NOTCH target transcripts in treated and untreated hiMPs (N=3; error bars; S.E.M.). Statistical analysis (paired t test) performed on ΔCt values whilst graphs were produced as fold change relative to untreated controls. (E) Curated dot plot Gene Ontology (GO; left), Kyoto Encyclopaedia of Genes and Genomes (KEGG; centre) and Reactome (right) enrichment analyses showing shared gene functions amongst the cell groups; numbers in brackets: genes analysed with a p value threshold set at 0.05; full lists in a dedicated spreadsheet available in Supplemental Information.

Article Snippet: Recombinant human DLL4 (DLL4 fused with the Fc domain of human IgG; R&D Systems; 1506-D4) was resuspended to a final concentration of 10 μg/ml in sterile PBS containing 1% wt/vol bovine serum albumin (BSA; Sigma-Aldrich; A9418-10G) as a carrier protein.

Techniques: Derivative Assay, Expressing, Biomarker Discovery, Real-time Polymerase Chain Reaction, Produced

Journal: bioRxiv

Article Title: DLL4 and PDGF-BB regulate migration of human iPSC-derived skeletal myogenic progenitors

doi: 10.1101/2021.02.28.431778

Figure Lengend Snippet: (A) Top cellular and molecular functions associated with DLL4 & PDGFBB modulation generated via ingenuity pathway analysis (IPA). Genes upregulated in the DLL4 & PDGFBB-treated hiMPs relative to the untreated control were subjected to IPA to reveal the predicted most significant associated functions. (B) Fluorescence microscopy images depicting Hoechst-positive nuclei of each cell at sequential time points. Coloured tails represent the locations of the nuclei at previous time points. (C) Unsupervised hierarchical clustering (Ward’s method) visualised with a t-SNE plot showing two distinct clusters (Silhouette Si = 0.19) (n = 408) (perplexity = 35). Cells pooled from 3 independent experimental replicates for each condition were used (untreated and DLL4 & PDGF-BB-treated). (D) Bar chart demonstrating normalised values for comparison of motility phenotypes between cells within the two clusters (mean ±SEM). Statistical significance based on Bonferroni-corrected t -test: all parameters except “hurst_RS” and “autocorr” are statistically significant between the two groups p<0.01 (data points: single cells pooled together from 3 independent experiments). (E) Bar graph displaying the proportions of control and DLL4 & PDGF-BB-treated cells within each cluster. (F) Functional protein association network analysis ( https://string-db.org ). The network view summarises predicted associations for proteins positively regulating cell migration common to all three datasets. The nodes are proteins and the edges represent the predicted functional associations. Red line: fusion evidence; Green line: neighbourhood evidence; Blue line: co-occurrence evidence; Purple line: experimental evidence; Yellow line: text mining evidence; Light blue line: database evidence; Black line: co-expression evidence. Blue nodes: GO:0030335 positive regulation of cell migration, Count in gene set: 8 of 452, false discovery rate: 0.0156. (G) P value-adjusted hierarchical clustering heatmap displaying hierarchical clustering of genes associated with leukocyte trans-endothelial migration (KEGG pathway: hsa04670; P set at 0.05). (H) Assessment of DLL4 & PDGF-BB-treated WT and genetically corrected DMD hiMP migration through a layer of endothelial cells. Representative images showing the lower side of the trans-well membrane on which treated and untreated hiMPs (stained with the transient dye CFDA, in green) are simultaneously seeded on HUVECs for 8 hours. Bar graphs quantifying the average number of CFDA-positive cells/ mm 2 , that have migrated through the endothelial layer in each considered condition. (N = 3). A minimum of 10 (1.5 mm 2 ) fields per condition was quantified (mean ±SEM). Scale bar: 250 μm. (I) Bar graph showing fold-change in trans-endothelial migration (mean ±SEM). Statistical significance based on one-way ANOVA with Bonferroni’s multiple comparison.

Article Snippet: Recombinant human DLL4 (DLL4 fused with the Fc domain of human IgG; R&D Systems; 1506-D4) was resuspended to a final concentration of 10 μg/ml in sterile PBS containing 1% wt/vol bovine serum albumin (BSA; Sigma-Aldrich; A9418-10G) as a carrier protein.

Techniques: Generated, Control, Fluorescence, Microscopy, Comparison, Functional Assay, Migration, Expressing, Membrane, Staining

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Neuroinflammation in the post-ischemic human and murine brain. a – c Immunohistochemical staining of CD45 + ( a ), Iba1 + ( b ), and CD68 + ( c ) microglia/macrophages in human post-mortem ischemic brain tissue. d – i Immunohistochemical staining of TNF + ( d ), TNFR1 + ( e ), TNFR2 + ( f ), IL-1β + ( g ), IL-1α + ( h ), and IL-1Ra + ( i ) cells in human post-mortem ischemic brain tissue. ( j, k ) Immunofluorescence double staining showing co-localization of IL-6 to NeuN + neurons ( j ), but absence of IL-6 to CD11b + microglia/macrophages ( k ) in the murine brain after pMCAO. l Immunofluorescence double staining showing co-localization of IL-6R to NeuN + neurons in the murine brain after pMCAO. Unpublished images of CD45, Iba1, CD68, TNF, TNFR1, TNFR2, and IL-1Ra stained tissue sections were acquired from human post-mortem ischemic brain tissue processed as previously described [ , ] using already published protocols, except for IL-1β and IL-1α. Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad). Unpublished images of IL-6 and IL-6R co-localized cells were acquired from parallel tissue sections from mice subjected to pMCAO as described in . In images a – i , Toluidine blue was used as a counterstain and in j – l , DAPI was used as a nuclear marker. Scale bars: a , i = 40 μm, j = 20 μm, and k , l = 20 μm. IL interleukin, IL-6R interleukin-6 receptor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor. The use of human brains was approved by the Danish Biomedical Research Ethical committee for the Region of Southern Denmark (permission number S-20080042) as stated in the original references

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Immunohistochemical staining, Staining, Immunofluorescence, Double Staining, Marker

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Studies on anti-cytokine treatments in experimental and human stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Injection, Functional Assay, Recombinant, Plasmid Preparation, Clinical Proteomics, Infection

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Mechanistic profile of cytokine and cytokine receptor agonists/antagonists for use in experimental stroke

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Bioprocessing, Dominant Negative Mutation, Recombinant

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Temporal profile of cytokine and cytokine receptor upregulation in the acute phase after pMCAO. a Graphical presentation of the temporal profile of TNF, LTα, TNFR1, and TNFR2 mRNAs in the same ischemic hemispheres from mice subjected to pMCAO. b Graphical presentation of the temporal profile of IL-1β, IL-1α, IL-1Ra, IL-1R1, and IL-1R2 mRNAs after pMCAO. c Graphical presentation of the temporal profile of IL-6, IL-6R, and gp130 mRNAs after pMCAO. Data are presented as relative increases in mRNA levels compared with unmanipulated controls. TNF, TNFR1 and TNFR2 mRNA data have been obtained from [ , ], whereas LTα mRNA data are unpublished data performed on the same experimental mice and conditions as . The sequence of the LTα TaqMan probe was AGGAGGGAGTTGTTGCTCAAAGAGAAGCCA, for the LTα sense primer it was CTGCTGCTCACCTTGTTGGG, and for the LTα antisense primer it was TAGAGGCCACTGGTGGGGAT. IL-1α, IL-1β, IL-1Ra, IL-1R1, and IL-1R2 mRNA data have been obtained from . IL-6, IL-6R, and gp130 mRNA data have been obtained from . Note the logarithmic Y axis. gp130 glycoprotein 130, IL interleukin, IL-6R interleukin-6 receptor, LT α lymphotoxin-alpha, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Sequencing

Journal: Acta Neuropathologica

Article Title: Post-stroke inflammation—target or tool for therapy?

doi: 10.1007/s00401-018-1930-z

Figure Lengend Snippet: Schematics presenting mechanisms of actions of approved and selected experimental cytokine and cytokine receptor agonists and antagonists. a – c TNF ( a ), IL-1 ( b ), and IL-6 ( c ) signaling via their receptors and mechanisms of actions of approved and selected novel inhibitors. Figures are modified using Protein Lounge Pathway Database ( www.proteinlounge.com ). Ab antibody, gp130 glycoprotein 130, icIL-1Ra intracellular interleukin-1 receptor antagonist, IL interleukin, IL-1Ra interleukin-1 receptor antagonist, IL-1R1 interleukin-1 receptor type 1, IL-1R2 interleukin-1 receptor type 2, IL-1RAcP IL-1 receptor accessory protein, sIL-1RAcP soluble IL-1 receptor accessory protein, IL-6R interleukin-6 receptor, sgp130 soluble glycoprotein 130, solIL-6R soluble interleukin-6 receptor, solTNF soluble tumor necrosis factor, tmTNF transmembrane tumor necrosis factor, TNF tumor necrosis factor, TNFR tumor necrosis factor receptor

Article Snippet: Staining for IL-1β and IL-1α was performed using similar protocols and the following antibodies: Human IL-1α Ab (monoclonal mouse IgG 2A , clone #4414, 1:1,200, R&D Systems) and human IL-1β Ab (monoclonal mouse IgG1, clone #2E8, 1:50, BioRad).

Techniques: Modification

Journal: Disease Models & Mechanisms

Article Title: The glucocorticoid receptor acts locally to protect dystrophic muscle and heart during disease

doi: 10.1242/dmm.050397

Figure Lengend Snippet: Deletion of the GR worsens dystrophic cardiomyopathy. (A) qRT-PCR confirmed knockout of the GR in the mouse heart. (B) Functional knockout of the GR was confirmed by assaying a known cardiomyocyte GR target gene ( Ptgds ). (C,D) Deletion of the GR in dKO versus mdx52 mice resulted in visibly enlarged hearts (C) and a significant increase in heart mass (D). Scale bars: 4 mm. (E) The hypertrophy genes Acta2 and Myh7 were significantly upregulated in dKO hearts. (F) The inflammatory transcripts Ccl2 and Il6 were significantly upregulated specifically in dKO hearts. (G,H) Echocardiography of aged mice showed a worsening of dystrophic cardiomyopathy in 1-year-old dKO versus mdx52 mice ( n ≥4 per group). (G) Representative M-mode images of the parasternal short axis. (H) Quantification of heart function via the ejection fraction demonstrates systolic dysfunction (left). Left ventricular (LV) wall thickness (right) measured at diastole showed an increase for dKO mice. n ≥6 mice per group unless otherwise specified. Data show mean±s.e.m. (significant outlier removed from F after ROUT test). * P ≤0.05; ** P ≤0.005; *** P ≤0.0005; **** P ≤0.0001; unpaired two-tailed t -test of Cre-positive versus control littermate genotypes.

Article Snippet: The assay IDs were: Cre recombinase, Mr00635245_cn; GR ( Nr3c1 ), Mm00433832_m1; dystrophin at its 3′ end, 00464531_m1; Ccl2 , Mm00441242_m1; Il1b , Mm00434228_m1; Il6 , Mm00446190_m1; Tlr7 , Mm00446590_m1; Ptgds , Mm01330613_m1; Acta2 , Mm01546133_m1; Acta1 , Mm00808218_g1; Myh7 , Mm00600555_m1; Hprt , Mm01545399_m1; and 18S rRNA, Mm03928990_g1. qRT-PCR data were normalized to the geometric mean of the levels of the control Hprt gene and 18S rRNA. miRNAs were quantified using individual TaqMan assays on the QuantStudio 7 real-time PCR machine as previously described ( ).

Techniques: Quantitative RT-PCR, Knock-Out, Functional Assay, Two Tailed Test, Control

Journal: Cell reports

Article Title: IL-17-induced dimerization of IL-17RA drives the formation of the IL-17 signalosome to potentiate signaling

doi: 10.1016/j.celrep.2022.111489

Figure Lengend Snippet: Functional response of WT and A104E IL-17RA N/TERT cells stimulated for 6 h with (A) IL-17A ± 1 ng/mL TNFα or (B) IL-17F ± TNFα after which IL36G mRNA induction was quantified by qRT-PCR. Left side: Concentration-response curves of IL36G mRNA induction (n = 4). Right side: EC 50 values and statistical significance of response between WT and A104E IL-17RA cells. (C) EC 50 values for CXCL1 mRNA induction by IL-17A or IL-17F ± 1 ng/mL TNFα in WT and A104E IL-17RA cells. Shown is mean ± SEM (n = 4). *p < 0.05, **p < 0.01, and ***p < 0.001. Color code: blue, WT IL-17RA cells; red, A104E IL-17RA cells.

Article Snippet: One-step qRT-PCR was done according to the manufacturers’ instructions (TaqMan® RNA-to-Ct™ 1-Step Kit Thermofisher # 4392656) using primer probe sets (Thermofisher) for human IL36G (Hs00219742_m1) and CXCL1 (Hs00236937_m1).

Techniques: Functional Assay, Quantitative RT-PCR, Concentration Assay